Metagenomics in Streptomyces lividans reveals host - dependent functional expression 1 2 3 Running Title : Functional metagenomics in Streptomyces lividans 4 5 Matthew

25 Most functional metagenomic studies have been limited by the poor expression of many genes 26 derived from metagenomic DNA in Escherichia coli, which has been the predominant surrogate 27 host to date. To expand the range of expressed genes, we developed tools for construction and 28 functional screening of metagenomic libraries in Streptomyces lividans. We expanded on 29 previously published protocols by constructing a system that enables retrieval and 30 characterization of the metagenomic DNA from biologically active clones. To test the 31 functionality of these methods, we constructed and screened two metagenomic libraries in S. 32 lividans. One was constructed with pooled DNA from 14 bacterial isolates cultured from 33 Alaskan soil and the second with DNA directly extracted from the same soil. Functional 34 screening of these libraries identified numerous clones with hemolytic activity, one clone that 35 produces melanin by a previously unknown mechanism, and one that induces the overproduction 36 of a secondary metabolite native to S. lividans. All bioactive clones were functional in S. 37 lividans but not in E. coli demonstrating the advantages of screening metagenomic libraries in 38 more than one host. 39 40 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom INTRODUCTION 41 The existing repertoire of microbially derived medically, agriculturally and industrially 42 useful enzymes and natural products originates from readily culturable organisms (28). 43 However, the vast majority of microorganisms cannot be cultured with standard laboratory 44 techniques, which necessitates alternative methods for accessing the metabolic potential of the 45 uncultured organisms (33). Metagenomics, the sequenceand function-based analysis of the 46 collective genomes of assemblages of organisms, provides such access (10, 15, 18, 36). 47 One approach to metagenomic analysis is functional metagenomics, which uses activity48 based screens and selections to filter the genetic material from a community through a 49 heterologous host. These screens reveal functional genes that code for desired biological 50 activities, independent of their similarity to previously known genes. Functional metagenomics, 51 therefore, can identify genes coding for biological activities of interest that would be missed with 52 sequence-based analysis (17). Moreover, functional metagenomics couples a specific biological 53 activity to genetic information, facilitating rapid identification and characterization of the genes 54 and gene products involved in the biological activity. Among the diverse biological activities 55 revealed using functional metagenomics are antimicrobial activity (8, 15, 24, 34), antibiotic 56 resistance determinants (2), quorum-sensing mimics (16, 42), and enzymes with diverse 57 functions (19, 20, 27). Many of these metabolites and activities would have been difficult to 58 predict based on sequence information alone. 59 While the strength of functional metagenomics is the identification of biological activity 60 independent of sequence, the weakness of this approach is its dependence on the ability of the 61 surrogate host to transcribe the metagenomic DNA efficiently, translate the mRNA to form a 62 functional protein, produce the necessary cofactors and substrates, and localize the protein 63 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom correctly. Escherichia coli is predicted to readily express 40% of environmental genes; however, 64 this value drops to 7% for high GC% Actinomycete DNA (14). Therefore, functional 65 metagenomics using E. coli as a heterologous host may underrepresent the metabolic potential of 66 Actinomycetes. Alternative hosts may increase the success of functional metagenomics by 67 providing expression machinery suited to genes from diverse organisms (34). For example, E. 68 coli, Streptomyces lividans, and Pseudomonas putida containing various antibiotic biosynthetic 69 gene clusters produced variable levels of antibiotics (25) and six species of Proteobacteria 70 differed in expression of metagenomic genes of interest (9). These studies demonstrate that 71 functionally screening metagenomic libraries in alternative hosts provides access to different 72 metabolic potential than in E. coli alone. 73 The choice of a suitable host is a critical factor for maximizing biological activity 74 detection in functional metagenomics (26). Factors to consider include simplicity in handling, 75 favorable growth characteristics, availability of genetic tools, and appropriate cellular machinery 76 for protein or metabolite production and activity (41). S. lividans makes an excellent host for 77 functional metagenomics of soil bacterial communities because Streptomyces species and other 78 Actinomycetes have abundant metabolic potential, are common soil inhabitants, and are 79 evolutionarily distant from E. coli, thereby expanding the diversity of genes likely to be 80 expressed beyond those expressed in E. coli (14). The well-developed methods of genetic 81 transfer from E. coli into S. lividans also contribute to the power of Streptomyces spp. as 82 surrogate hosts. We chose S. lividans over other genetically tractable streptomycetes such as S. 83 coelicolor because S. lividans has a less active restriction-modification system, enabling it to 84 accept foreign DNA more efficiently (39). 85 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom Two prior studies used Streptomyces as a heterologous host in sequence-based 86 metagenomic analysis, in which clones of interest were identified by sequence, then mobilized 87 into a heterologous host for functional analysis (8, 38). These studies demonstrated that 88 Streptomyces expressed genes derived from metagenomic DNA, but the discovered genetic 89 information was limited to genes amplified by PCR primers specific to several classes of 90 secondary metabolites. Functional metagenomics has the potential to locate previously unknown 91 metabolic capabilities using screens that identifying active clones based on function rather than 92 known signature sequences in the genes. The benefits of using S. lividans for identification of 93 new biosynthetic potential are best exemplified in the first published use of a streptomycete 94 heterologous host for functional metagenomics, which used an HPLC-ESIMS screen to identify 95 clones that produced members of the terragine and norcardamine natural product families (40). 96 Importantly, this study reported a much higher frequency of biologically active clones than that 97 detected in E. coli or any other heterologous host (26). However, one weakness in this approach 98 was the inability to quickly retrieve the metagenomic DNA for molecular analysis. Therefore, 99 these was no simple means for demonstrating the metagenomic DNA was causative of the 100 observed biological activity and subsequent genetic studies to target genes of interest were not 101 straightforward. 102 Here we report the development and deployment of tools and methods for using S. 103 lividans as a host for functional metagenomic libraries. We constructed libraries, conjugated 104 them into S. lividans, screened them for functions expressed in S. lividans, and characterized 105 bioactive clones. The methodology described in this work provides the means to expand the 106 accessible genes in functional metagenomic studies to include those of the metabolically rich 107 Actinomycetes. 108 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom Materials and Methods 109 110 Construction of cosmid pMM436. Cosmid pOJ436 (5) was modified to contain PacI 111 restriction sites that flanked attP and int. To accomplish this, each PacI site was added 112 independently in a stepwise manner. For insertion of the first PacI restriction site, the NcoI/ClaI 113 fragment of pOJ436 was subcloned into the corresponding sites of plasmid pANT841 (32), 114 resulting in plasmid pANT841-NcoI/ClaI. Quickchange PCR-based mutagenesis (Agilent 115 Technologies, Santa Clara, CA, USA) was used to replace the HindIII site with a PacI site in 116 plasmid pANT841-NcoI/ClaI using primers PacI For (5' 117 GCCCGTTGCGCATGTTAATTAAGACCGATGGCCGGTTTG 3') and PacI Rev (5' 118 CAAACCGGCCATCGGTCTTAATTAACATGCGCAACGGGC 3'). Successful transformants 119 were subsequently screened for PacI site insertion by restriction digestion. The NcoI/ClaI 120 fragment containing the introduced PacI site was subcloned into the corresponding sites of 121 pOJ436, resulting in plasmid pOJ436-PacI. A second PacI restriction site was inserted between 122 the BamHI and SpeI sites of plasmid pOJ436-PacI by introducing a small DNA fragment 123 containing a PacI restriction site flanked by BamHI and SpeI restriction sites using primers PacI 124 For (5' GCCCGTTGCGCATGTTAATTAAGACCGATGGCCGGTTTG 3') and PacI Rev (5' 125 CAAACCGGCCATCGGTCTTAATTAACATGCGCAACGGGC 3'). Insertion of the PacI site 126 was confirmed by sequencing, and the final cosmid was designated pMM436. 127 A second version of pMM436 containing a kanamycin resistance gene (neo) within the 128 PacI-flanked fragment of pMM436 containing the attP site and int gene was constructed to 129 expedite the reconstruction of the cosmid once it is recovered from the S. lividans genome (see 130 below). The construction of pMM436-Kan was accomplished by amplifying the neo gene from 131 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom pSuperCOS1 (Stratagene) using primers Neo-Up-SpeI (5′ 132 CATACTAGTAAAGCAGGTAGCTTGCAGTGG 3′) and Neo-Down-SpeI (5′ 133 CATACTAGTAACCTTTCATAGAAGGCGGC 3′). The amplicon was digested with SpeI and 134 inserted into the SpeI restriction site of pMM436, generating plasmid pMM436-Kan. 135 136 Construction of S. lividans ΔredΔact strain. The methods for deletion of S. lividans gene 137 clusters were modified from previously reported protocols (25). 138 (i) S. lividans Δred. Deletion of the prodiginine (red) biosynthesis gene cluster involved 139 fusing the first 2 kb of the cluster to the final 2 kb, with concomitant removal of the intervening 140 DNA. This was accomplished using the temperature-sensitive vector pKC1139 (5). Briefly, 141 pKC1139 is a Streptomyces/E. coli shuttle vector with an origin of replication that is temperature 142 sensitive in Streptomyces. The first 2 kb of the red cluster were cloned into the HindIII/BamHI 143 restriction sites of pKC1139, while the final 2 kb of the red cluster were cloned into the 144 BamHI/EcoRI restriction sites. The resulting plasmid, pKC1139Δred, was conjugated from E. 145 coli into S. lividans and the deletion of the intervening sequence was accomplished by successive 146 temperature shifts and antibiotic selections and screens following standard protocols (37). 147 Confirmation of the Δred genotype was confirmed by PCR amplification. The primers used to 148 construct pKC1139Δred were: redD For (5′ 149 GACGGCCAAGCTTCCTCGACCTTGTGGACCTCGTCGGTGCGCATCA 3′), redD Rev (5′ 150 GATCATCGGGTCGTCTGGGATCCCGGTCGTCAGGCGCTGAGCAGGCTGGTGT 3′), 151 redoxidase For (5′ 152 CGCCTGACGACCGGGATCCCAGACGACCCGATGATCCCCAACCAGTGG 3′), and 153 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom redoxidase Rev (5′ CGGGAATTCGCGGGGTCAGTACACGTAGGGGACGAACTTC 3′). The 154 resulting strain is designated S. lividans Δred. 155 (ii) S. lividans ΔredΔact. Deletion of the actinorhodin (act) biosynthesis gene cluster 156 followed the same protocol as outlined above. The pKC1139Δact plasmid was constructed using 157 the following primers: actVI For (5′ GAAAGCTTTCGGCAGCGCGTCAGGGTGTCA 3′) and 158 actVI Rev (5′ GGGATCCCTACTGCCTGGTGCTCACCGTCCAC 3′); actlysR2 For (5′ 159 GGGATCCCACGAGGGTGGTTGGCGTCGGAACAAGGC 3′) and actlysR2 Rev (5′ 160 CGGAATTCCAGGAAGCACAGGACGCCGAGGACGAAC 3′). The mutagenesis was 161 performed on S. lividans Δred, resulting in strain S. lividans ΔredΔact. 162 163 Construction of metagenomic libraries. pMM436 was prepared by digestion with HpaI 164 followed by phosphatase treatment, digested with BamHI and used in library construction. 165 (i) Library AKM1. Fourteen isolates from Alaskan soil were grown to saturation in 166 0.1X trypticase soy broth. The cells were pelleted by centrifugation and then resuspended in 23 167 ml of 10% (v/v) glycerol, then frozen in 1.5 ml aliquots until use. Chromosomal DNA was 168 extracted from 250 μl of cells using an established protocol (30). DNA (0.75 μg) was partially 169 digested to an approximate size of 30-40 kb with Sau3AI and ligated into the BamHI site of 170 pMM436 (1.5 μg). The ligation mixture was packaged into phage using MaxPlax Lambda 171 Packaging Extracts (Epicentre, Madison, WI, USA) and transduced into E. coli Epi300. 172 Transductants were isolated by selecting on LB containing apramycin (100 μg/ml). A total of 173 10,500 clones were isolated and then pooled by adding 600 μl LB medium to each plate and 174 scraping colonies into suspension. All colonies were pooled, mixed, and resuspended in a final 175 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom concentration of 10% (v/v) DMSO and stored in 1.5-ml aliquots at -80°C. Restriction digestion 176 analysis of 10 randomly chosen clones determined an average insert size of 35 kb. 177 (ii) Library AKM2. Cells were physically isolated from 100 g of Alaskan soil from 178 Bonanza Creek Experimental Forest near Fairbanks, Alaska by a previously published cell 179 separation method (42). The cell pellets were flash frozen and stored at -80°C. Metagenomic 180 DNA was extracted from cell pellets using the protocol described above for AKM1. The optimal 181 condition for partial digestion of 0.2 μg metagenomic DNA was digestion with 240 units BclI at 182 50°C for 1.5 h, which resulted in 30-40 kb fragments. The digested DNA was dephosphorylated, 183 ethanol precipitated, resuspended in 14 μl water and ligated with pMM436 (1.5 μg). Optimal 184 ligation was achieved by incubating the ligating DNA at 18°C over three days in a ligation 185 reaction supplemented with 0.8 μl of 0.1 M ATP and 400 cohesive end units of ligase every 24 h. 186 The ligated DNA was packaged into phage, transduced, selected and stored (in pools of 4,000) as 187 described above. 188 189 Conjugation of DNA libraries into S. lividans ΔredΔact. Cosmid libraries were conjugated 190 into S. lividans by standard triparental mating between E. coli Epi300 strains carrying cosmids, 191 E. coli HB101 containing the helper plasmid pRK2013 (13), and S. lividans ΔredΔact (21). 192 Exconjugants were selected on MS agar (21) overlaid with apramycin (50 μg/ml) and naladixic 193 acid (20 μg/ml). 194 195 Functional screening of metagenomic clones. Individual metagenomic clones in S. lividans 196 ΔredΔact were patched onto MS agar, incubated 30°C until sporulation was evident, and replica 197 printed (31) onto three plates of ISP2 agar (35) and one plate of blood agar (Becton, Dickinson 198 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom and Company, Sparks, MA, USA). The original MS plate was retained as the master plate and 199 stored at 4°C. The replication plates were incubated at 30°C for five days and screened for 200 pigmentation, sporulation, and hemolytic activity. Tester organisms, Staphylococcus aureus, 201 Pseudomonas aeruginosa PAO1, and E. coli pJBA132 were inoculated into soft agar (Davis 202 medium for S. aureus and P aeruginosa (12)), and LB for E. coli (42) and poured over 203 metagenomic clones on ISP2 and incubated at 37°C overnight. Plates were inspected visually 204 for antibiotic activity and, in the case of E. coli pJBA132, microscopically with a GFP filter for 205 fluorescence, which indicates induction of quorum sensing (Leica MZ FLIII; Leica 206 Microsystems, Deerfield, IL) (excitation wavelength, 470/40 nm; barrier filter, 525/50 nm). The 207 metagenomic library pools screened in S. lividans ΔredΔact were also screened in E. coli Epi300 208 for pigments and alterations of colony morphology. 209 210 Confirming bioactivity of clones. Genomic DNA was extracted from active clones using the 211 DNA extraction protocol used for library construction. The PacI restriction enzyme was used to 212 excise the cosmid and metagenomic DNA from the S. lividans chromosome. The PacI enzyme 213 was heat-inactivated and the DNA was self-ligated and transformed into E. coli Epi300. 214 Transformants selected on LB plates with apramycin (100 μg/ml) contained metagenomic DNA 215 and most of the vector. To confirm that the metagenomic DNA was responsible for the detected 216 bioactivity, the PacI fragment of pMM436-kan containing attP, int and neo was inserted into 217 PacI digested cosmid. The reconstructed cosmid was then conjugated into S. lividans ΔredΔact 218 and the resulting exconjugants and the clones in E. coli Epi300 were tested for the original 219 bioactivity. Only those clones showing the original activity in S. lividans were characterized 220 further. 221 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom 222 Characterization of bioactive clones. Active clones with consistent phenotypes were each 223 initially characterized using the same protocols, while further analysis was tailored to each clone. 224 Several functional screens did not detect clones with bioactivities consistent enough to warrant 225 characterization. 226 (i) Sequence analysis of bioactive clones. The cosmids of bioactive clones were 227 partially digested and ligated into vector pSMART-HCKan using the CloneSmart Blunt Cloning 228 Kit (Lucigen, Middleton, WI, USA). The inserts were sequenced (UW Biotechnology Center), 229 then assembled into contigs using SeqMan Lasergene software (DNASTAR, Madison, WI, 230 USA). Putative genes responsible for bioactivities were annotated using BLAST (Basic Local 231 Alignment Tool) (3, 4) and SeqBuilder (DNASTAR). The sequences for these clones have 232 accession numbers: JQ430656, JQ430657, JQ43-658, JQ437404. 233 (ii) Deletion analysis of bioactive clones. Insertional inactivation of targeted genes was 234 performed using lambda red mutagenesis in E. coli containing plasmid pKD46 (11). Lambda red 235 recombination was used to replace targeted genes with a chloramphenicol-resistance gene 236 amplified from the template plasmid pKD3 (11) using unique primers for each insertion (Table 237 3). For clone 12, the insertional inactivation of both peptidase-encoding genes on the same 238 cosmid was accomplished by inserting the chloramphenicol-resistance gene into the gene coding 239 for the S15-peptidase homolog, followed by FLP recombinase-based elimination of the 240 resistance gene to leave a “scar” (11). The subsequent inactivation of the second peptidase on 241 the scar-containing cosmid was conducted using lambda red-mediated mutagenesis of the other 242 peptidase-encoding gene. The overall schemes for further characterization of clones are 243 on O cber 5, 2017 by gest ht://aem .sm .rg/ D ow nladed fom described below. After PCR confirmation of insertions and scar, the mutated cosmids were 244 conjugated into S. lividans ΔredΔact and tested for alteration of the original phenotype. 245 246 (iii) Cloning of candidate genes from bioactive clones. Candidate genes for observed 247 bioactivity were inserted into pSET152, a vector that can be conjugated from E. coli and S. 248 lividans (5). We used polymerase incomplete primer extension methods (22) with unique 249 primers for each gene (Table 3) to amplify and insert target genes into pSET152. The plasmids 250 were then conjugated into S. lividans ΔredΔact and the resulting strains were phenotypically 251 characterized. E. coli Epi300 containing these plasmids were also screened for observed 252